IGDB.NSCLC Gene View
 
Gene Information        (help)
Gene MET Ensembl ENSG00000105976 Chromosome 7 Start 116099682 End 116225676
Description Hepatocyte growth factor receptor Precursor (HGF receptor)(EC 2.7.10.1)(Scatter factor receptor)(SF receptor)(HGF/SF receptor)(Met proto-oncogene tyrosine kinase)(c-Met) [Source:UniProtKB/Swiss-Prot;Acc:P08581]
GENE RESOURCES :NUCLEOTIDE SEQUENCES :PROTEIN RESOURCES :CLINICAL RESOURCES :REFERENCES :
     HGNC : 7029
     Entrez Gene : 4233
     UCSC : uc003vij.2
     GeneCards : 7029
     RefSeq : NM_000245
     CCDS : CCDS43636.1
     Uniprot : P08581
     Interpro : P08581
     OMIM : 164860
     GeneTests : MET
     CGAP : MET
     PMID : 1846706

< Top >


Somatic Mutaions        (help)
Lung cancer Adenocarcinoma Squamous Cell Carcinoma
Unique Mutated Samples % Mutated Total Unique
Samples
Unique Mutated
Samples
% Mutated Total Unique
Samples
Unique Mutated
Samples
% Mutated Total Unique
Samples
40 2.55 1570 15 2.36 635 1 1.15 87
Sample datas
Sample Name Histology Subtype DNA Mutation Protein Mutation Mutation Description Zygosity Genomic Co-ordinates NCBI36 Pubmed
1067575 AD c.2942-27delAAGCTCTTTCTTTCTCTCTGTT p.? Unknown Heterozygous 7:116199112-11619913316397241
1067576 AD c.3062_3082del21 p.? Unknown Heterozygous 7:116199259-11619928616397241
1170248 AD c.2942_3082del141 p.982_1028del47 Unknown Heterozygous 7:116199280-11619928019096300
1170249 AD c.2942_3082del141 p.982_1028del47 Unknown Heterozygous 7:116199123-11620217419096300
1170250 AD c.2942_3082del141 p.982_1028del47 Unknown Heterozygous 7:116199092-11619911119096300
1170251 AD c.2942_3082del141 p.L982_D1028del Deletion - In frame Unknown 7:116199139-11619927919096300
1170252 AD c.2942_3082del141 p.L982_D1028del Deletion - In frame Unknown 7:116199139-11619927919096300
1170253 AD c.2942_3082del141 p.982_1028del47 Unknown Heterozygous 7:116199121-11619913119096300
1170254 AD c.2942_3082del141 p.L982_D1028del Deletion - In frame Unknown 7:116199139-11619927919096300
16640 AD c.2942-20del22 p.? Unknown Heterozygous 7:116199119-11619914018948947
16835 AD c.3061T>A p.Y1021N Substitution - Missense Heterozygous 7:116199258-11619925818948947
17055 AD c.3778G>T p.G1260C Substitution - Missense Heterozygous 7:116210685-11621068518948947
917259 AD c.687G>T p.L229F Substitution - Missense Heterozygous 7:116127061-11612706115735036
917361 AD c.2942_3082del141 p.D981_D1028del Deletion - In frame Homozygous 7:116199139-11619927915735036
INP313 AD c.? p.N375S Substitution - Missense Heterozygous 18709663
INP313 AD c.? p.V370D Substitution - Missense Heterozygous 18709663
1067608 SCC c.3376G>K p.A1126S Substitution - Missense Unknown 7:116204741-11620474116397241

< Top >


Experimental Evidence        (help)
Expression Sample Number Method Clinical information PubMed Reference
up 14/23(61%) IHC- 15735036 Cancer Res. 2005 Feb 15;65(4):1479-88.

< Top >


Microarray Gene Expression Fold Change Result        (help)
( red: up-regulation / green : down-regulation when p value < 0.01)
( gray background : these probesets might have mapping problems. ref 1, ref 2)
Chip Type Probeset Adenocarcinoma Squamous Cell Carcinoma
Fold Change p value q value Fold Change p value q value
 HG_U95  1608_at  0.27  1.94e-1  2.85e-1  0.15  6.11e-1  7.02e-1
 HG_U95  1609_g_at  0.43  7.03e-2  1.23e-1  0.11  6.76e-1  7.58e-1
 HG_U95  1812_s_at  0.44  7.15e-2  1.25e-1  -0.44  1.99e-1  2.89e-1
 HG_U95  35684_at  0.33  9.05e-2  1.52e-1  -0.12  4.77e-1  5.81e-1
 HG_U133A  203510_at  0.38  6.03e-2  8.25e-2  -1.10  9.14e-21  1.34e-20
 HG_U133A  211599_x_at  0.52  2.91e-7  7.93e-7  -3.45  2.31e-63  6.61e-63
 HG_U133A  213807_x_at  0.76  2.03e-11  8.22e-11  0.48  6.12e-10  7.66e-10
 HG_U133A  213816_s_at  0.19  8.65e-2  1.15e-1  4.13  1.03e-105  8.15e-105
 HG_U133_Plus2  203510_at  0.10  6.43e-1  7.17e-1  -0.49  1.38e-4  3.03e-4
 HG_U133_Plus2  211599_x_at  0.67  3.51e-4  1.00e-3  0.41  7.34e-3  1.23e-2
 HG_U133_Plus2  213807_x_at  0.70  1.52e-3  3.80e-3  0.34  1.14e-1  1.51e-1
 HG_U133_Plus2  213816_s_at  1.05  5.57e-6  2.23e-5  0.18  3.24e-1  3.84e-1
 Stanford  3791  0.10  8.38e-1  9.11e-1  -0.49  2.27e-1  4.60e-1
 Stanford  17793  0.02  9.70e-1  9.84e-1  -0.40  2.07e-1  4.35e-1
 Agilent_HS_21.6K  19402  0.04  2.31e-3  1.49e-2  0.03  6.88e-2  1.57e-1

< Top >


Adjuvant Cisplatin/vinorelbine Treatment vs Observation Result        (help) (Pubmed)
( red: up-regulation / green : down-regulation when p value < 0.01)
( gray background color : the mapping problems of probeset. ref_1, ref_2)
Chip Type Probeset Adenocarcinoma Squamous Cell Carcinoma
Fold Change p value q value Fold Change p value q value
 HG_U133A  203510_at  -0.83  1.77e-1  8.20e-1  -0.25  4.39e-1  1.00e+0
 HG_U133A  211599_x_at  -0.33  2.71e-1  8.64e-1  -0.20  2.47e-1  1.00e+0
 HG_U133A  213807_x_at  -0.73  6.05e-2  7.24e-1  -0.27  2.72e-1  1.00e+0
 HG_U133A  213816_s_at  -0.28  3.38e-1  8.87e-1  -0.10  5.28e-1  1.00e+0

< Top >


Microarray Sample Data        (help)
( The log2 value of tumor samples )
(Average : Average log2 value from Normal Samples.)
        HG_U95 - 1608_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U95 - 1609_g_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U95 - 1812_s_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U95 - 35684_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133A - 203510_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133A - 211599_x_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133A - 213807_x_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133A - 213816_s_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133_Plus2 - 203510_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133_Plus2 - 211599_x_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133_Plus2 - 213807_x_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        HG_U133_Plus2 - 213816_s_at    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        Stanford - 3791    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        Stanford - 17793    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

        Agilent_HS_21.6K - 19402    (back)       Save as a PNG file. Save as a PDF file. Save as a PS file.
Gene expression figure

< Top >


Cancer Gene Index        (help)

If 0 entry was found, please remove the search key "lung cancer".
Keyword DiseaseData Statement PubMed Organism
hgfr tumor EXPERIMENTAL DESIGN: To address this question, we analyzed the extent of EGFR and HGFR expression in gastrinomas from 38 patients with Zollinger-Ellison syndrome and correlated it with clinical and tumor characteristics. 12114431 Human
hgfr liver metastases Maximal EGFR and HGFR mRNA levels were 4- and 1.2-fold increased and correlated with the presence of liver metastases (P = 0.034) and decreased long-term curability (P = 0.027) but not tumor location, size, or tumor functional characteristics. 12114431 Human
hgfr tumor Maximal EGFR and HGFR mRNA levels were 4- and 1.2-fold increased and correlated with the presence of liver metastases (P = 0.034) and decreased long-term curability (P = 0.027) but not tumor location, size, or tumor functional characteristics. 12114431 Human
hgfr tumors Amplification of the Hgfr/Met oncogene, located at RNO4q21.2, was detected by fluorescence in situ hybridization (FISH) in five tumors. 11241796 Rat
hgfr tumor In the fifth tumor (BL150T), Hgfr/Met was amplified in all cells and was the sole amplified gene of those tested. 11241796 Rat
hgfr tumors In addition, the Hgfr/Met FISH signals in BL150T were tightly clustered and formed compact and intense spots compared with the signals seen in the other four tumors. 11241796 Human
oncogene met cancer Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. 11705871 Human
oncogene met esophageal squamous-cell carcinoma (escc) Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. 11705871 Human
oncogene met tumor Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. 11705871 Human
oncogene met tumor CONCLUSIONS: Multiple cancer-related genes are differentially expressed in ESCC, the oncogene MET is overexpressed in ESCC compared with normal esophageal epithelium, and its protein overexpression correlates with tumor differentiation in ESCC. 11705871 Human
hgfr renal carcinoma Taken together, our results indicate that the overexpression of HGFR causes increase in cellular motility and PI3-kinase shows the important contribution on the increased motility of renal carcinoma cells. 11753639 Human
hgfr tumors Southern blotting detected no amplification of the Hgfr/Met gene in the 35 tumors examined, in contrast to our recent report of Hgfr/Met gene amplification in 7, 12-dimethylbenz(a)anthracene (DMBA)-induced rat sarcomas. 10702398 Human
hgfr tumors In summary, both amplification and overexpression of the Hgfr/Met gene was found in about 25% of DMBA-induced experimental rat sarcomas, and HGF receptor overexpression alone was seen in two additional tumors. 10359528 Rat
hgfr pancreatic carcinoma In comparison, pancreatic carcinoma cell lines commonly demonstrated overexpression of EGFR, erbB2, TGF-alpha, Met/HGFR, VEGF, and KGF, but they consistently showed marked down-regulation of amphiregulin mRNA expression. 9665487 Human
hgfr tumours METHODS: This study searched for the mRNA expression pattern of six tyrosine- and serine/threonine kinase receptors [hepatocyte growth factor (HGFR), fibroblast growth factor (FGFR), epidermal growth factor (EGFR), insulin-like growth factor (IGF)-1R, tra 9893017 Human
hgfr insulinomas METHODS: This study searched for the mRNA expression pattern of six tyrosine- and serine/threonine kinase receptors [hepatocyte growth factor (HGFR), fibroblast growth factor (FGFR), epidermal growth factor (EGFR), insulin-like growth factor (IGF)-1R, tra 9893017 Human
hgfr carcinoid syndrome METHODS: This study searched for the mRNA expression pattern of six tyrosine- and serine/threonine kinase receptors [hepatocyte growth factor (HGFR), fibroblast growth factor (FGFR), epidermal growth factor (EGFR), insulin-like growth factor (IGF)-1R, tra 9893017 Human
hgfr gastric cancer Hepatocyte growth factor (HGF) was found to stimulate the growth and progression of gastric cancer cells through hepatocyte growth factor receptor (HGFR). 9413205 Human
hgfr human gastric cancer In the present study, the effects of HGF on the expression of HGFR in relation to cell cycle progression of human gastric cancer cells were investigated by two-parameter flow cytometric analysis. 9413205 Human
hgfr gastric cancer We found that the expression of HGFR in SC-M1 and KATO-III gastric cancer cells was cycle dependent, the level of HGFR increased from GO-G1 to S phase and the highest level of HGFR was found in G2-M phases. 9413205 Human
hgfr gastric cancer These results suggest that functional HGFR rather than overexpressed HGFR may be more important for the growth of gastric cancer cells. 9413205 Human
hgfr carcinoma In infiltrating ductal carcinomas, intense expression of HGFR mRNA was not restricted to ductular structures but as also seen in non-duct-forming carcinoma cells. 8546209 Human
hgfr cancer The expression of HGF and HGFR genes are unregulated in several types of human cancer; therefore, understanding the control mechanisms governing HGF and HGFR gene expression is of great clinical interest. 8527900 Human
hgfr human leukemia The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma. 8289471 Human
hgfr tumors Southern blot and pulsed field gel electrophoresis experiments did not show any rearrangement in a region of 600 kb around the Met/HGF receptor gene excluding an activation of Met/HGFR by a TPR/Met oncogenic rearrangement as described for MNNG-HOS cells a 8289471 Human
hgfr human leukemia Our data indicate that the Met/HGFR gene is deregulated in a few cases of human leukemia, Burkitt's lymphoma and Hodgkin's disease possibly by chromosomal rearrangements resulting in an overexpression of the normal Met/HGF receptor mRNA and prot 8289471 Human
hgfr burkitt's lymphoma Our data indicate that the Met/HGFR gene is deregulated in a few cases of human leukemia, Burkitt's lymphoma and Hodgkin's disease possibly by chromosomal rearrangements resulting in an overexpression of the normal Met/HGF receptor mRNA and prot 8289471 Human
oncogene met glioma Two independent amplification events on chromosome 7 in glioma: amplification of the epidermal growth factor receptor gene and amplification of the oncogene MET. 8017863 Human
oncogene met glioblastoma The oncogene MET was amplified in a glioblastoma which showed no EGFR gene amplification. 8017863 Human
hgfr renal carcinoma We examined the role of increased expression of HGFR kinase in in vivo growth of renal carcinoma. 12646256 Mouse
hgfr renal carcinoma Human renal carcinoma cell line, ACHN cells, was transfected with plasmid encoding wild-type HGFR gene to generate cell lines with increased HGFR protein. 12646256 Human
hgfr renal carcinoma These results indicate for the first time that overexpression of HGFR tyrosine kinase in renal carcinoma cells participates in rapid tumor growth in vivo. 12646256 Mouse
hgfr tumor These results indicate for the first time that overexpression of HGFR tyrosine kinase in renal carcinoma cells participates in rapid tumor growth in vivo. 12646256 Mouse
hepatocyte growth factor receptor colorectal carcinomas Amplification of the c-met gene, that encodes hepatocyte growth factor receptor, was examined on human esophageal, gastric and colorectal carcinomas. 1333188 Human
hepatocyte growth factor receptor gastric carcinoma We examined mRNA expression for c-met encoding hepatocyte growth factor receptor in 8 gastric carcinoma cell lines and 31 surgically resected gastric carcinoma tissues by Northern-blot analysis. 8344755 Human
hepatocyte growth factor receptor lymphoma The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma. 8289471 Human
hepatocyte growth factor receptor human leukemia The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma. 8289471 Human
hepatocyte growth factor receptor liver tumours Expression of hepatocyte growth factor mRNA, and c-met mRNA (hepatocyte growth factor receptor) in human liver tumours. 7989714 Human
hepatocyte growth factor receptor human pancreatic cancer Expression of the Met/hepatocyte growth factor receptor in human pancreatic cancer. 7866999 Human
hepatocyte growth factor receptor tumors Expression of Met/hepatocyte growth factor receptor gene and malignant behavior of musculoskeletal tumors. 8863670 Human
hepatocyte growth factor receptor carcinomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the met proto-oncogene, has been associated with tumor progression in different human carcinomas. 8863670 Human
hepatocyte growth factor receptor tumor Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the met proto-oncogene, has been associated with tumor progression in different human carcinomas. 8863670 Human
hepatocyte growth factor receptor head and neck squamous cell carcinomas Detection of MET oncogene/hepatocyte growth factor receptor in lymph node metastases from head and neck squamous cell carcinomas. 9065649 Human
hepatocyte growth factor receptor lymph-node metastases Detection of MET oncogene/hepatocyte growth factor receptor in lymph node metastases from head and neck squamous cell carcinomas. 9065649 Human
hepatocyte growth factor receptor papillary thyroid carcinomas Negative/low expression of the Met/hepatocyte growth factor receptor identifies papillary thyroid carcinomas with high risk of distant metastases. 9215314 Human
hepatocyte growth factor receptor metastases Negative/low expression of the Met/hepatocyte growth factor receptor identifies papillary thyroid carcinomas with high risk of distant metastases. 9215314 Human
hepatocyte growth factor receptor thyroid cancer To investigate the clinical impact of Met/hepatocyte growth factor receptor (HGF-R) expression in thyroid cancer we studied 163 thyroid carcinomas (129 papillary, 21 follicular, and 13 anaplastic) from patients followed-up for 25-147 months postthyroidect 9215314 Human
hepatocyte growth factor receptor thyroid carcinomas To investigate the clinical impact of Met/hepatocyte growth factor receptor (HGF-R) expression in thyroid cancer we studied 163 thyroid carcinomas (129 papillary, 21 follicular, and 13 anaplastic) from patients followed-up for 25-147 months postthyroidect 9215314 Human
hepatocyte growth factor receptor glioblastomas Previously, we reported amplification of the protooncogene MET (hepatocyte growth factor receptor; 7q31) in more than 20% of glioblastomas. 9402967 Human
hepatocyte growth factor receptor gastric cancer Hepatocyte growth factor (HGF) was found to stimulate the growth and progression of gastric cancer cells through hepatocyte growth factor receptor (HGFR). 9413205 Human
hepatocyte growth factor receptor tumours Higher grade tumours tended to express it in the cytoplasm, suggesting that the role of c-Met as the hepatocyte growth factor receptor was blocked in higher grade tumours. 9539204 Human
hepatocyte growth factor receptor gastric carcinoma The relation between the growth patterns of gastric carcinoma and the expression of hepatocyte growth factor receptor (c-met), autocrine motility factor receptor, and urokinase-type plasminogen activator receptor. 9610690 Human
hepatocyte growth factor receptor tumor cell migration BACKGROUND: Hepatocyte growth factor receptor (c-met), autocrine motility factor receptor (AMFR), and urokinase-type plasminogen activator receptor (uPAR) are known to play important roles in tumor cell migration, invasion, and metastasis. 9610690 Human
hepatocyte growth factor receptor metastasis BACKGROUND: Hepatocyte growth factor receptor (c-met), autocrine motility factor receptor (AMFR), and urokinase-type plasminogen activator receptor (uPAR) are known to play important roles in tumor cell migration, invasion, and metastasis. 9610690 Human
hepatocyte growth factor receptor tumor We therefore characterized, by Northern blot and/or immunohistochemistry, the relative expression of three effectors involved in the invasion, angiogenesis, and dissemination of tumor cells in esophageal cancer versus nontumoral mucosae: (a) stromelysin-3 9626453 Human
hepatocyte growth factor receptor esophageal cancer We therefore characterized, by Northern blot and/or immunohistochemistry, the relative expression of three effectors involved in the invasion, angiogenesis, and dissemination of tumor cells in esophageal cancer versus nontumoral mucosae: (a) stromelysin-3 9626453 Human
hepatocyte growth factor receptor hepatocellular carcinoma (hcc) In the present retrospective study, liver cell dysplasia (LCD) occurring in cirrhotic livers associated or not associated with hepatocellular carcinoma (HCC) was immunohistochemically analyzed for the expression of hepatocyte growth factor receptor (c-met 9690121 Human
hepatocyte growth factor receptor non-small cell lung cancers Differential expression of Met/hepatocyte growth factor receptor in subtypes of non-small cell lung cancers. 9699182 Human
hepatocyte growth factor receptor colorectal cancer [The expression of cMET/hepatocyte growth factor receptor in colorectal cancer] In this study, we estimated the expression of c-MET/Hepatocyte Growth Factor receptor in colorectal cancers by immunohistochemistry. 9721515 Human
hepatocyte growth factor receptor tumor METHODS: An RT-PCR plus Southern blot assay was used to detect mRNA of tumor markers in blood and tissues. mRNA expression of the tumor progression markers MET (hepatocyte growth factor receptor gene c-met), GalNAc-T (beta1,4- N-acetyl-galactosaminyl-tran 10699892 Human
hepatocyte growth factor receptor pancreatic carcinoma METHODS: An RT-PCR plus Southern blot assay was used to detect mRNA of tumor markers in blood and tissues. mRNA expression of the tumor progression markers MET (hepatocyte growth factor receptor gene c-met), GalNAc-T (beta1,4- N-acetyl-galactosaminyl-tran 10699892 Human
hepatocyte growth factor receptor tumors The expression of Met/hepatocyte growth factor receptor gene in giant cell tumors of bone and other benign musculoskeletal tumors. 10867643 Human
hepatocyte growth factor receptor giant cell tumors of bone The expression of Met/hepatocyte growth factor receptor gene in giant cell tumors of bone and other benign musculoskeletal tumors. 10867643 Human
hepatocyte growth factor receptor carcinomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the MET proto-oncogene, is involved in transformation and invasive behavior of human carcinomas and sarcomas. 10867643 Human
hepatocyte growth factor receptor sarcomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the MET proto-oncogene, is involved in transformation and invasive behavior of human carcinomas and sarcomas. 10867643 Human
hepatocyte growth factor receptor metastasis The epidermal growth factor receptor (EGFR) and the hepatocyte growth factor receptor (c-Met) are two such receptor tyrosine kinases (RTKs) that have been causally implicated in colorectal carcinoma (CRC) progression and metastasis. 11125542 Human
hepatocyte growth factor receptor colorectal carcinoma (crc) The epidermal growth factor receptor (EGFR) and the hepatocyte growth factor receptor (c-Met) are two such receptor tyrosine kinases (RTKs) that have been causally implicated in colorectal carcinoma (CRC) progression and metastasis. 11125542 Human
hepatocyte growth factor receptor childhood hepatocellular carcinomas Somatic mutations in the kinase domain of the Met/hepatocyte growth factor receptor gene in childhood hepatocellular carcinomas. 9927037 Human
hepatocyte growth factor receptor sarcomas Amplification and overexpression of the hepatocyte growth factor receptor (HGFR/MET) in rat DMBA sarcomas. 10359528 Rat
hepatocyte growth factor receptor ks KS cells synthesize and secrete HGF and express the hepatocyte growth factor receptor (c-Met), thus providing an autocrine loop for tumor proliferation and neovascularization which can be enhanced by proinflammatory cytokines. 10408347 Human
hepatocyte growth factor receptor tumor KS cells synthesize and secrete HGF and express the hepatocyte growth factor receptor (c-Met), thus providing an autocrine loop for tumor proliferation and neovascularization which can be enhanced by proinflammatory cytokines. 10408347 Human
hepatocyte growth factor receptor hereditary papillary renal cancer In addition, study of the Wilms' tumor suppressor, WT1, is revealing much about the pathogenesis of Wilms' tumor, urogenital development, and glomerular podocyte biology. c-met, the gene encoding the hepatocyte growth factor receptor, has recent 10456263 Human
hepatocyte growth factor receptor necrosis Hepatocyte growth factor receptor in acute tubular necrosis. 11181801 Rat
hepatocyte growth factor receptor bone metastasis Expression of CD31, Met/hepatocyte growth factor receptor and bone morphogenetic protein in bone metastasis of osteosarcoma. 11169148 Human
hepatocyte growth factor receptor osteosarcoma Expression of CD31, Met/hepatocyte growth factor receptor and bone morphogenetic protein in bone metastasis of osteosarcoma. 11169148 Human
hepatocyte growth factor receptor human tumors Overexpression of hepatocyte growth factor receptor (c-met) has been detected in many human tumors. 11669338 Human
hepatocyte growth factor receptor renal carcinoma Increase in hepatocyte growth factor receptor tyrosine kinase activity in renal carcinoma cells is associated with increased motility partly through phosphoinositide 3-kinase activation. 11753639 Human
hepatocyte growth factor receptor lung carcinoma High expression of Met/hepatocyte growth factor receptor suppresses tumorigenicity in NCI-H1264 lung carcinoma cells. 11795945 Human
hepatocyte growth factor receptor human hepatocellular carcinoma [Epitope of somatic mutations in the hepatocyte growth factor receptor naturally processed and presented by HLA-A2 on human hepatocellular carcinoma] OBJECTIVE: To isolate and identify peptides bound to HLA I on human hepatocellular carcinoma. 11798848 Human
hepatocyte growth factor receptor hepatocellular carcinoma The most promising candidate for T cell epitope was nonamers peptide (SLIVHLNEV), derived from met/hepatocyte growth factor receptor, point mutation was 1180F to L. CONCLUSION: Sensitive sequencing by HPLC-MS may provide a powerful method of identifying t 11798848 Human
hepatocyte growth factor receptor tumor The most promising candidate for T cell epitope was nonamers peptide (SLIVHLNEV), derived from met/hepatocyte growth factor receptor, point mutation was 1180F to L. CONCLUSION: Sensitive sequencing by HPLC-MS may provide a powerful method of identifying t 11798848 Human
hepatocyte growth factor receptor metastasis In this study of gastric cancer, we evaluated whether IGF-2 (insulin-like growth factor-2), c-MET (hepatocyte growth factor receptor), MMP-7 (matrix metalloproteinase-7) and MUC-1, which are associated with nodal metastasis from primary tumor, are concern 11813625 Human
hepatocyte growth factor receptor primary tumor In this study of gastric cancer, we evaluated whether IGF-2 (insulin-like growth factor-2), c-MET (hepatocyte growth factor receptor), MMP-7 (matrix metalloproteinase-7) and MUC-1, which are associated with nodal metastasis from primary tumor, are concern 11813625 Human
hepatocyte growth factor receptor gastric cancer In this study of gastric cancer, we evaluated whether IGF-2 (insulin-like growth factor-2), c-MET (hepatocyte growth factor receptor), MMP-7 (matrix metalloproteinase-7) and MUC-1, which are associated with nodal metastasis from primary tumor, are concern 11813625 Human
hepatocyte growth factor receptor primary tumors Primary tumors were analyzed for p53 expression using IHC staining and for beta-human chorionic gonadotropin (beta-hCG), hepatocyte growth factor receptor (c-Met), and universal melanoma antigen (uMAGE) messenger RNA expression using reverse-transcriptase 12470104 Human
hepatocyte growth factor receptor tumor Autocrine activation of the hepatocyte growth factor receptor/met tyrosine kinase induces tumor cell motility by regulating pseudopodial protrusion. 12372820 Human
hepatocyte growth factor receptor fibrolamellar hepatocellular carcinoma To determine whether these factors contribute to the distinct etiologies of fibrolamellar hepatocellular carcinoma and traditional hepatocellular carcinoma, we assayed hepatocyte growth factor, the hepatocyte growth factor receptor, and two hepatocyte gro 12527708 Human
hepatocyte growth factor receptor hepatocellular carcinoma To determine whether these factors contribute to the distinct etiologies of fibrolamellar hepatocellular carcinoma and traditional hepatocellular carcinoma, we assayed hepatocyte growth factor, the hepatocyte growth factor receptor, and two hepatocyte gro 12527708 Human
hepatocyte growth factor receptor hepatocellular carcinomas Furthermore, 8/9 fibrolamellar hepatocellular carcinomas demonstrated hepatocyte growth factor receptor levels similar to normal, whereas 8/9 hepatocellular carcinomas and 11/12 cirrhotic livers exhibited either an increase or decrease. 12527708 Human
hepatocyte growth factor receptor fibrolamellar hepatocellular carcinomas Furthermore, 8/9 fibrolamellar hepatocellular carcinomas demonstrated hepatocyte growth factor receptor levels similar to normal, whereas 8/9 hepatocellular carcinomas and 11/12 cirrhotic livers exhibited either an increase or decrease. 12527708 Human
hepatocyte growth factor receptor papillary thyroid carcinoma Hepatocyte growth factor receptor, matrix metalloproteinase-11, tissue inhibitor of metalloproteinase-1, and fibronectin are up-regulated in papillary thyroid carcinoma: a cDNA and tissue microarray study. 12538453 Human
hepatocyte growth factor receptor tumor Overexpression of hepatocyte growth factor receptor in renal carcinoma cells indirectly stimulates tumor growth in vivo. 12646256 Mouse
hepatocyte growth factor receptor renal carcinoma Overexpression of hepatocyte growth factor receptor in renal carcinoma cells indirectly stimulates tumor growth in vivo. 12646256 Mouse
hepatocyte growth factor receptor cancer The met oncogene, encoding the high affinity hepatocyte growth factor receptor, is the only known gene inherited in human cancer that is invariably associated with somatic duplication of the mutant locus. 12746450 Human
hepatocyte growth factor receptor prostate cancer Prostate cancer and the met hepatocyte growth factor receptor. 15327888 Human
hepatocyte growth factor receptor hepatoma SU5416 is a potent inhibitor of hepatocyte growth factor receptor (c-Met) and blocks HGF-induced invasiveness of human HepG2 hepatoma cells. 15288476 Human
hepatocyte growth factor receptor metastasis CONCLUSIONS: Inhibition of various solid tumors growth and metastasis by SU5416 may be partially attributed to blocking activation of the hepatocyte growth factor receptor. 15288476 Human
hepatocyte growth factor receptor solid tumors CONCLUSIONS: Inhibition of various solid tumors growth and metastasis by SU5416 may be partially attributed to blocking activation of the hepatocyte growth factor receptor. 15288476 Human
hepatocyte growth factor receptor human gastric cancer Activation of c-Met (hepatocyte growth factor receptor) in human gastric cancer tissue. c-Met is a high-affinity receptor for hepatocyte growth factor (HGF) and plays a crucial role in embryonic development, as well as in the process of tissue repair. 15504247 Human
hepatocyte growth factor receptor melanoma RESULTS: Hepatocyte growth factor receptor c-met, growth factor receptor-bound protein 10, B-raf proto-oncogene, and several mitogen-activated protein kinase kinase genes were significantly up-regulated in melanoma metastases and several melanoma cell lin 15724012 Human
hepatocyte growth factor receptor metastases RESULTS: Hepatocyte growth factor receptor c-met, growth factor receptor-bound protein 10, B-raf proto-oncogene, and several mitogen-activated protein kinase kinase genes were significantly up-regulated in melanoma metastases and several melanoma cell lin 15724012 Human
hepatocyte growth factor receptor cancers Increased hepatocyte growth factor receptor (HGFR) signaling correlates closely with neoplastic invasion and metastatic potential of many human cancers. 15882443 Human
hgfr gastric tumors Southern blot and pulsed field gel electrophoresis experiments did not show any rearrangement in a region of 600 kb around the Met/HGF receptor gene excluding an activation of Met/HGFR by a TPR/Met oncogenic rearrangement as described for MNNG-HOS cells a 8289471 Human
hgfr hodgkin's disease Our data indicate that the Met/HGFR gene is deregulated in a few cases of human leukemia, Burkitt's lymphoma and Hodgkin's disease possibly by chromosomal rearrangements resulting in an overexpression of the normal Met/HGF receptor mRNA and prot 8289471 Human
hgfr hepatomas METHODS: The gene expression of HGF and HGFR in the canceration course of rats was determined by using experimental hepatomas model of Wistar rats established by diethylnitrosamine (DENA), with digoxigenin-labled probe. 9275531 Human
hgfr neuroendocrine tumours METHODS: This study searched for the mRNA expression pattern of six tyrosine- and serine/threonine kinase receptors [hepatocyte growth factor (HGFR), fibroblast growth factor (FGFR), epidermal growth factor (EGFR), insulin-like growth factor (IGF)-1R, tra 9893017 Human
hgfr cancer Given the recent recognition that some growth factor receptors can form heterodimers with CD44, the present study was undertaken to determine whether the CD44 and growth factor receptors (e.g., EGFR, FGFR, HGFR, VEGFR, TGF-betaRI, or TGF-betaRII) can form 15597342 Human
hgfr cancers Increased hepatocyte growth factor receptor (HGFR) signaling correlates closely with neoplastic invasion and metastatic potential of many human cancers. 15882443 Human
met proto-oncogene glioblastoma The met proto-oncogene was found to be amplified in a human glioblastoma cell line (T3095) established from a glioblastoma multiform WHO grade IV. 8280494 Human
met proto-oncogene hepatocellular carcinoma Expression of c-met was determined by Northern-blot hybridization of a specific probe (human met proto-oncogene) in 18 tumoral and nontumoral liver samples obtained in 18 cirrhotic patients with hepatocellular carcinoma submitted to surgical treatment. 8276372 Human
met proto-oncogene tumors Met proto-oncogene product is overexpressed in tumors of p53-deficient mice and tumors of Li-Fraumeni patients. 7728766 Human
met proto-oncogene rhabdomyosarcomas Retrogenic expression of the MET proto-oncogene correlates with the invasive phenotype of human rhabdomyosarcomas. 8622890 Human
met proto-oncogene rhabdomyosarcoma These data indicate that aberrant expression of the MET proto-oncogene provides rhabdomyosarcoma cells with the same property as embryonal myoblasts to migrate into the surrounding connective tissues. 8622890 Human
met proto-oncogene carcinomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the met proto-oncogene, has been associated with tumor progression in different human carcinomas. 8863670 Human
met proto-oncogene tumor Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the met proto-oncogene, has been associated with tumor progression in different human carcinomas. 8863670 Human
met proto-oncogene osteosarcomas The finding of Met/HGF receptor overexpression in all of the osteosarcomas suggests a role for the met proto-oncogene in the pathogenesis of this tumor. 8863670 Human
met proto-oncogene tumor The finding of Met/HGF receptor overexpression in all of the osteosarcomas suggests a role for the met proto-oncogene in the pathogenesis of this tumor. 8863670 Human
met proto-oncogene papillary renal carcinomas Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas. 9140397 Human
met proto-oncogene papillary renal carcinomas The results suggest that missense mutations located in the MET proto-oncogene lead to constitutive activation of the MET protein and papillary renal carcinomas. 9140397 Human
met proto-oncogene hereditary papillary renal carcinoma Two North American families with hereditary papillary renal carcinoma and identical novel mutations in the MET proto-oncogene. 9563489 Human
met proto-oncogene renal-cell tumours Duplication and overexpression of the mutant allele of the MET proto-oncogene in multiple hereditary papillary renal cell tumours. 9715275 Human
met proto-oncogene epithelial ovarian tumors [Evaluation of Ron and Met proto-oncogene expression in epithelial ovarian tumors] BACKGROUND: Epithelial ovarian cancer is the most lethal gynecologic neoplasia. 10638160 Human
met proto-oncogene sporadic papillary renal cell carcinomas Mapping of the 7q31 subregion common to the small chromosome 7 derivatives from two sporadic papillary renal cell carcinomas: increased copy number and overexpression of the MET proto-oncogene. 10698493 Human
met proto-oncogene papillary renal cell carcinomas Our results indicate that expression of the MET proto-oncogene above a critical threshold is required for the maintenance of the tumorigenic phenotype of at least some papillary renal cell carcinomas, but does not further increase during tumour progressio 10698493 Human
met proto-oncogene tumour Our results indicate that expression of the MET proto-oncogene above a critical threshold is required for the maintenance of the tumorigenic phenotype of at least some papillary renal cell carcinomas, but does not further increase during tumour progressio 10698493 Human
met proto-oncogene carcinomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the MET proto-oncogene, is involved in transformation and invasive behavior of human carcinomas and sarcomas. 10867643 Human
met proto-oncogene sarcomas Overexpression of the hepatocyte growth factor receptor (Met/HGF receptor), a transmembrane tyrosine kinase encoded by the MET proto-oncogene, is involved in transformation and invasive behavior of human carcinomas and sarcomas. 10867643 Human
met proto-oncogene giant cell tumors In this study, we analyzed 40 biopsy samples of a collection of giant cell tumors and other rare benign tumors of bone for expression of the MET proto-oncogene. 10867643 Human
met proto-oncogene benign tumors of bone In this study, we analyzed 40 biopsy samples of a collection of giant cell tumors and other rare benign tumors of bone for expression of the MET proto-oncogene. 10867643 Human
met proto-oncogene kidney cancer In an effort to develop a rapid, sensitive mutation detection method for studies of families with inherited kidney cancer, we evaluated DHPLC for detection and analysis of MET proto-oncogene mutations in papillary renal carcinomas (PRC). 10874308 Human
met proto-oncogene papillary renal carcinomas (prc) In an effort to develop a rapid, sensitive mutation detection method for studies of families with inherited kidney cancer, we evaluated DHPLC for detection and analysis of MET proto-oncogene mutations in papillary renal carcinomas (PRC). 10874308 Human
met proto-oncogene epithelial cancers So far, two genes that predispose to epithelial cancers of the kidney have been identified, VHL and the MET proto-oncogene. 10966853 Human
met proto-oncogene papillary renal carcinomas Novel mutations of the MET proto-oncogene in papillary renal carcinomas. 10327054 Human
met proto-oncogene papillary renal carcinomas Previously, we demonstrated missense mutations in the tyrosine kinase domain of the MET proto-oncogene in HPRC and a subset of sporadic papillary renal carcinomas. 10327054 Human
met proto-oncogene solid tumors In this study, we screened a large panel of sporadic papillary renal carcinomas and various solid tumors for mutations in the MET proto-oncogene. 10327054 Human
met proto-oncogene papillary renal carcinomas In this study, we screened a large panel of sporadic papillary renal carcinomas and various solid tumors for mutations in the MET proto-oncogene. 10327054 Human
met proto-oncogene other solid tumors Summarizing these and previous results, mutations of the MET proto-oncogene were detected in 17/129 sporadic papillary renal carcinomas but not in other solid tumors. 10327054 Human
met proto-oncogene papillary renal carcinomas Summarizing these and previous results, mutations of the MET proto-oncogene were detected in 17/129 sporadic papillary renal carcinomas but not in other solid tumors. 10327054 Human
met proto-oncogene renal-cell carcinomas Germline mutations in the tyrosine-kinase domain of the MET proto-oncogene were found in patients suffering from the hereditary predisposition to develop multiple papillary renal-cell carcinomas (hereditary PRCC, HPRCC). 10417759 Human
met proto-oncogene hereditary papillary renal cancer (hprc) Frequent mutations of Met proto-oncogene have been found in hereditary papillary renal cancer (HPRC) and most of the mutations are located in the tyrosine kinase domain. 10491015 Human
met proto-oncogene epithelial ovarian tumors (eots) The aim of this study to perform a mutation analysis of exons 17 19 of Met proto-oncogene in epithelial ovarian tumors (EOTs). 10491015 Human
met proto-oncogene papillary renal carcinoma Missense mutations in the tyrosine kinase domain of the MET proto-oncogene occur in selected cases of papillary renal carcinoma. 11354004 Human
met proto-oncogene testicular germ-cell tumors The MET proto-oncogene is not a major target for the gain of chromosome 7 in testicular germ-cell tumors of adolescents. 15007647 Human
met proto-oncogene hereditary papillary renal carcinoma Early onset hereditary papillary renal carcinoma: germline missense mutations in the tyrosine kinase domain of the met proto-oncogene. 15371818 Human
met proto-oncogene renal tumors PURPOSE: Hereditary papillary renal carcinoma (HPRC) is characterized by a predisposition to multiple, bilateral papillary type 1 renal tumors caused by inherited activating missense mutations in the tyrosine kinase domain of the MET proto-oncogene. 15371818 Human
met proto-oncogene hereditary papillary renal carcinoma (hprc) PURPOSE: Hereditary papillary renal carcinoma (HPRC) is characterized by a predisposition to multiple, bilateral papillary type 1 renal tumors caused by inherited activating missense mutations in the tyrosine kinase domain of the MET proto-oncogene. 15371818 Human
met proto-oncogene well-differentiated pancreatic endocrine neoplasms Met proto-oncogene and insulin-like growth factor binding protein 3 overexpression correlates with metastatic ability in well-differentiated pancreatic endocrine neoplasms. 15448002 Human
met proto-oncogene pancreatic endocrine neoplasms Immunohistochemical validation of microarray data were performed for two overexpressed genes, namely, the met proto-oncogene (MET) and insulin-like growth factor binding protein 3 (IGFBP3) with tissue microarrays of nonmetastatic (n=24) and metastatic (n= 15448002 Human
met proto-oncogene diffuse large b-cell lymphoma The expression and prognostic significance of hepatocyte growth factor (HGF) and its receptor c-MET (MET proto-oncogene) was analysed in 96 cases of diffuse large B-cell lymphoma (DLBCL). 15491290 Human
met proto-oncogene dlbcl The expression and prognostic significance of hepatocyte growth factor (HGF) and its receptor c-MET (MET proto-oncogene) was analysed in 96 cases of diffuse large B-cell lymphoma (DLBCL). 15491290 Human
met proto-oncogene papillary thyroid carcinoma For papillary thyroid carcinoma formation of fused genes of tyrosine kinases (RET proto-oncogene, NTRK1 proto-oncogene and met proto-oncogene) with other genes is typical. 15584614 Human
met proto-oncogene tumor As activating mutations in the MET proto-oncogene (the HGF receptor) cause familial RCC, we investigated whether HAI-2/SPINT2 might act as a RCC tumor suppressor gene. 15930277 Human
the met gene gastric carcinoma The p190MET kinase is constitutively phosphorylated on tryosine in a gastric carcinoma cell line (GTL16), due to the amplification and overexpression of the MET gene. 1655790 Human
the met gene hepatic disorders In order to elucidate the function of the Met gene product in hepatic disorders, we analyzed the expression and tyrosine phosphorylation of the Met protein on regeneration and carcinogenesis of the liver. 8157255 Human
the met gene cancers The MET gene, encoding the tyrosine kinase receptor for Hepatocyte Growth Factor, is a potentially harmful oncogene overexpressed in a significant fraction of human cancers. 8183564 Human
the met gene glioma Amplification of the MET gene in glioma. 7534113 Human
the met gene human breast cancer Human breast cancer: genetic alterations in the MET gene region. 8853570 Human
the met gene breast cancer OBJECTIVE: to test whether the MET gene at chromosome 7q31, which encodes a receptor protein (tyrosine kinase) related to normal histological differentiation, undergoes structural changes in breast cancer. 8853570 Human
the met gene papillary renal carcinomas We identified missense mutations located in the tyrosine kinase domain of the MET gene in the germline of affected members of HPRC families and in a subset of sporadic papillary renal carcinomas. 9140397 Human
the met gene carcinomas This information is relevant for the screening of recently reported mutations of the MET gene which cause hereditary papillary renal carcinomas and for the search for additional mutations of the same gene which may play a role in the pathogenesis of commo 9380410 Human
the met gene hereditary papillary renal carcinomas This information is relevant for the screening of recently reported mutations of the MET gene which cause hereditary papillary renal carcinomas and for the search for additional mutations of the same gene which may play a role in the pathogenesis of commo 9380410 Human
the met gene carcinomas of the breast This information is relevant for the screening of recently reported mutations of the MET gene which cause hereditary papillary renal carcinomas and for the search for additional mutations of the same gene which may play a role in the pathogenesis of commo 9380410 Human
the met gene glioblastomas Although the extent of the amplified domain varied, the close vicinity of the MET gene was the only region consistently amplified in these glioblastomas. 9402967 Human
the met gene neoplasia The identification of the H1112R mutation will facilitate predictive testing in HPRC and guide future studies of the MET gene in human neoplasia. 9563489 Human
the met gene renal tumor These findings suggest that the earliest renal tumor in patients with an activating hereditary mutation of the met gene is papillary basophilic renal cancer. 10647647 Human
the met gene renal cancer These findings suggest that the earliest renal tumor in patients with an activating hereditary mutation of the met gene is papillary basophilic renal cancer. 10647647 Human
the met gene gastric carcinomas Absence of mutations in the kinase domain of the Met gene and frequent expression of Met and HGF/SF protein in primary gastric carcinomas. 10752688 Human
the met gene gastric carcinomas We analyzed the expression of these genes and the mutations in the kinase domain of the Met gene in 43 gastric carcinomas. 10752688 Human
the met gene carcinomas The MET gene is expressed in epithelia and over-expressed in carcinomas of specific histotypes, but not in lymphatic tissue. 10861506 Human
the met gene tumor Altogether, these data demonstrate that the MET gene product is a valuable marker with which to detect occult tumor cells in lymph nodes, thanks to its high expression in metastatic cells. 10861506 Human
the met gene papillary renal carcinoma We recently described germline and somatic mutations in the MET gene associated with papillary renal carcinoma type 1. 10871851 Human
the met gene glioma Missense mutation of the MET gene detected in human glioma. 11007037 Human
the met gene gliomas Three of 11 sporadic gliomas showed a deletion of one copy of the MET gene, and a specific METgene missense mutation in the remaining gene copy was detected in one of those tumors. 11007037 Human
the met gene tumors Three of 11 sporadic gliomas showed a deletion of one copy of the MET gene, and a specific METgene missense mutation in the remaining gene copy was detected in one of those tumors. 11007037 Human
the met gene gliomas Three of 11 sporadic gliomas showed duplication of one copy of the MET gene, but none of them contained mutations. 11007037 Human
the met gene primary liver cancers We performed PCR-based single-strand conformational polymorphism and sequencing analysis of the tyrosine kinase domain of the MET gene (exon 15-19) in 75 primary liver cancers. 9927037 Human
the met gene hcc Our results indicate that mutations of the tyrosine kinase domain of the MET gene may be involved in the acceleration of the carcinogenesis in childhood HCC. 9927037 Human
the met gene breast tumours Infrequent mutations of the MET gene in sporadic breast tumours. 10446461 Human
the met gene papillary renal cell carcinomas Papillary renal cell carcinomas are caused by activating mutation in the tyrosine kinase domain of the MET gene. 11197838 Human
the met gene hereditary papillary renal carcinoma (hprc) To test this hypothesis, wild-type mouse Ron and three mutant forms of Ron containing mutations similar to those found in the Met gene in human hereditary papillary renal carcinoma (HPRC), were expressed in NIH3T3 cells. 11593422 Human
the met gene papillary renal cell carcinomas Oncogenic missense mutations of the tyrosine kinase domain of the MET gene have been identified in human papillary renal cell carcinomas. 12147692 Human
the met protein human tumour Structure of the met protein and variation of met protein kinase activity among human tumour cell lines. 3048352 Human
the met protein colon carcinoma In a colon carcinoma cell line (LoVo), the precursor is not cleaved and the Met protein is exposed at the cell surface as a single-chain polypeptide of 190 kDa (p190NC). 1658624 Human
the met protein hepatic disorders In order to elucidate the function of the Met gene product in hepatic disorders, we analyzed the expression and tyrosine phosphorylation of the Met protein on regeneration and carcinogenesis of the liver. 8157255 Human
the met protein human hepatocellular carcinomas To gain insights into its functions in the liver, we carried out a study of the expression and tyrosine phosphorylation status of the Met protein during hepatic regeneration and in human hepatocellular carcinomas. 8705780 Human
the met protein papillary renal carcinomas The results suggest that missense mutations located in the MET proto-oncogene lead to constitutive activation of the MET protein and papillary renal carcinomas. 9140397 Human
the met protein tumors Immunofluorescent staining and quantitative image analysis showed that the Met protein was expressed throughout the tumors and normal nasopharyngeal epithelia. 11809714 Human
the met protein malignant tumor Suppression of this signaling pathway by targeting the Met protein tyrosine kinase may be an ideal strategy for suppressing malignant tumor growth. 15520203 Human
hgfr tumors Since HGF and/or HGFR/met gene expression is seen in various tumors and the serum HGF level is elevated in patients with hepatic disease, the present results indicate a possible significance of HGF and its receptor system in carcinogenesis, most probably 8414505 Human
hgfr cancer Among the autocrine and paracrine loops that might be involved in the strong proliferative capacity of trophoblastic and cancer cells, epidermal growth factor (EGF)/EGF receptor (EGFR), hepatocyte growth factor (HGF)/HGF receptor (HGFR) (Met) and vascular 17068222 Human
hgfr epithelial tumors These results demonstrate that overexpression of HGF in at least some epithelial cells contribute to tumorigenesis, and furthermore suggest a possible role for the HGF-MET/HGFR system in the progression of certain epithelial tumors. 7553606 Human
hgfr carcinoma In 12 of 12 cases of ductal carcinoma in situ and infiltrating ductal carcinoma, carcinoma cells showed a heterogeneous pattern of expression for both HGFR and HGF mRNA. 8546209 Human
hgfr ductal carcinoma in situ In 12 of 12 cases of ductal carcinoma in situ and infiltrating ductal carcinoma, carcinoma cells showed a heterogeneous pattern of expression for both HGFR and HGF mRNA. 8546209 Human
hgfr infiltrating ductal carcinoma In 12 of 12 cases of ductal carcinoma in situ and infiltrating ductal carcinoma, carcinoma cells showed a heterogeneous pattern of expression for both HGFR and HGF mRNA. 8546209 Human
hgfr infiltrating ductal carcinomas In infiltrating ductal carcinomas, intense expression of HGFR mRNA was not restricted to ductular structures but as also seen in non-duct-forming carcinoma cells. 8546209 Human
hgfr tumors The same zones of the tumors (most commonly at the advancing margins) that expressed strongly HGFR mRNA often were also strongly positive for HGF mRNA, suggesting a possible autocrine effect. 8546209 Human
hgfr malignancy The finding that HGFR is expressed by both benign and malignant epithelium, and its not restricted to duct-forming structures, suggests that, although the potential for HGF/HGFR binding is maintained in malignancy, the response to ligand binding at the le 8546209 Human
hgfr hepatomas [Gene expression of HGF and its receptor in experimental hepatomas] OBJECTIVE: To understand the regularity of changes of gene expression about HGF and its receptor (HGFR) in experimental hepatomas model of Wistar rats and the relationship between this ch 9275531 Rat
hgfr tumor [Gene expression of HGF and its receptor in experimental hepatomas] OBJECTIVE: To understand the regularity of changes of gene expression about HGF and its receptor (HGFR) in experimental hepatomas model of Wistar rats and the relationship between this ch 9275531 Rat
hgfr metastasis HGF and HGFR systems play an important role in regulating tumor growth and metastasis. 9275531 Human
hgfr tumor HGF and HGFR systems play an important role in regulating tumor growth and metastasis. 9275531 Human
hgfr sarcomas Amplification and overexpression of the hepatocyte growth factor receptor (HGFR/MET) in rat DMBA sarcomas. 10359528 Rat
hgfr sarcomas Using probes for the two genes in FISH (fluorescence in situ hybridization) and in Southern blots we found that the Hgfr/Met gene was amplified in five of the 19 sarcomas studied, and that the Hgf gene was coamplified in two of them. 10359528 Rat
hgfr sarcomas In summary, both amplification and overexpression of the Hgfr/Met gene was found in about 25% of DMBA-induced experimental rat sarcomas, and HGF receptor overexpression alone was seen in two additional tumors. 10359528 Rat
hgfr sarcomas Southern blotting detected no amplification of the Hgfr/Met gene in the 35 tumors examined, in contrast to our recent report of Hgfr/Met gene amplification in 7, 12-dimethylbenz(a)anthracene (DMBA)-induced rat sarcomas. 10702398 Rat
hgfr sarcomas Hgfr/Met oncogene acts as target for gene amplification in DMBA-induced rat sarcomas: free chromatin fluorescence in situ hybridization analysis of amplicon arrays in homogeneously staining regions. 11241796 Rat
hgfr sarcomas Our results suggest that the Hgfr/Met oncogene is the primary target for amplification in a subset of rat DMBA sarcomas. 11241796 Rat
oncogene met esophageal squamous cell carcinoma (escc) Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. 11705871 Human
hgfr human papilloma The expression levels were similar in primary normal HPDE cells and those expressing transfected E6E7 genes of human papilloma virus-16, but their immortalization appeared to enhance the expression of EGFR and Met/HGFR. 9665487 Human
hgfr adenocarcinoma in situ To examine the importance of prohibitin 1 and c-Met/hepatocyte growth factor receptor (HGFR) expression in human cervical adenocarcinomas, 85 patients (69 with invasive adenocarcinoma [ACA] and 16 with adenocarcinoma in situ [AIS]) were studied using immu 16426920 Human
hgfr cervical adenocarcinomas To examine the importance of prohibitin 1 and c-Met/hepatocyte growth factor receptor (HGFR) expression in human cervical adenocarcinomas, 85 patients (69 with invasive adenocarcinoma [ACA] and 16 with adenocarcinoma in situ [AIS]) were studied using immu 16426920 Human
hgfr invasive adenocarcinoma To examine the importance of prohibitin 1 and c-Met/hepatocyte growth factor receptor (HGFR) expression in human cervical adenocarcinomas, 85 patients (69 with invasive adenocarcinoma [ACA] and 16 with adenocarcinoma in situ [AIS]) were studied using immu 16426920 Human
hgfr colorectal tumour This study quantified the mRNA expression of three putative reference genes (ubiquitin C, cyclophilin E, and porphobilinogen deaminase) and the target gene hepatocyte growth factor receptor (HGFR) in matched colorectal tumour and normal mucosa samples. 16458257 Human
hgfr tumour When HGFR expression was normalised to each of these reference genes using the 2 (-DeltaDeltaC(T)) method of relative quantification, the number of tumour samples in which HGFR was found to be over-expressed varied from 30% to 63% depending on the referen 16458257 Human
hgfr cancers PURPOSE: Hepatocyte growth factor receptor (HGFR/c-Met) signaling is associated with tumor progression in various cancers. 16914575 Human
hgfr tumor PURPOSE: Hepatocyte growth factor receptor (HGFR/c-Met) signaling is associated with tumor progression in various cancers. 16914575 Human
hgfr renal cell carcinoma (rcc) The clinical significance and pathologic roles of phosphorylated HGFR/c-Met in renal cell carcinoma (RCC) are not fully understood; therefore, this study sought to clarify the possible role of two tyrosine residues (pY1234/pY1235 and pY1349) in HGFR/c-Met 16914575 Human
hgfr tumor In addition, phosphorylated HGFR/c-Met expression (using phosphorylation site-specific antibodies for pY1234/pY1235 and pY1349) was examined in 114 tumor sections of conventional RCC patients by immunohistochemistry. 16914575 Human
hgfr cancer Median rates (range) of cancer cells immunopositive for pY1234/pY1235 HGFR/c-Met and pY1349 HGFR/c-Met in the tumor sections were 0% (0-5.2%) and 14.3% (0-64.3%), respectively. 16914575 Human
hgfr tumor Median rates (range) of cancer cells immunopositive for pY1234/pY1235 HGFR/c-Met and pY1349 HGFR/c-Met in the tumor sections were 0% (0-5.2%) and 14.3% (0-64.3%), respectively. 16914575 Human
hgfr carcinoma Positive expression of pY1349 HGFR/c-Met was significantly associated with high pT stage, presence of metastasis, and high-grade carcinoma. 16914575 Human
hgfr metastasis Positive expression of pY1349 HGFR/c-Met was significantly associated with high pT stage, presence of metastasis, and high-grade carcinoma. 16914575 Human
hgfr tumor CONCLUSIONS: Phosphorylated HGFR/c-Met may be important in the tumor progression of RCC. 16914575 Human
hgfr metastasis Expression of pY1349 HGFR/c-Met is a useful predictor for metastasis and survival of conventional RCC patients. 16914575 Human
hgfr tumorigenesis Hepatocyte growth factor (HGF) has been recently suggested to contribute to tumorigenesis by an autocrine mechanism in fibroblast cells overexpressing its receptor, the MET/HGFR protein. 7553606 Human
hgfr tumorigenesis Since epithelial cells represent the primary physiologic target of HGF, we investigated whether inappropriate expression of HGF by epithelial cells which normally express MET/HGFR may also contribute to tumorigenesis. 7553606 Human
hgfr tumorigenesis These results demonstrate that overexpression of HGF in at least some epithelial cells contribute to tumorigenesis, and furthermore suggest a possible role for the HGF-MET/HGFR system in the progression of certain epithelial tumors. 7553606 Human
hgfr lymphoma The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma. 8289471 Human
hgfr oncogenic Southern blot and pulsed field gel electrophoresis experiments did not show any rearrangement in a region of 600 kb around the Met/HGF receptor gene excluding an activation of Met/HGFR by a TPR/Met oncogenic rearrangement as described for MNNG-HOS cells a 8289471 Human
hgfr carcinogenesis Since HGF and/or HGFR/met gene expression is seen in various tumors and the serum HGF level is elevated in patients with hepatic disease, the present results indicate a possible significance of HGF and its receptor system in carcinogenesis, most probably 8414505 Human
hgfr adenocarcinoma We examined gene expression of hepatocyte growth factor (HGF) and HGF receptor (HGFR), or product of proto-oncogene c-met (c-met), in smokers and nonsmokers with adenocarcinoma (ADC) by suppression subtractive hybridization and microarray techniques. 16254251 Human
hgfr colorectal carcinoma (crc) We here demonstrate that HGFR activation promotes survival of colorectal carcinoma (CRC) cells exposed to conditions that mimic those met during tumor progression, i.e. nutrient deprivation or substrate detachment, and following chemotherapeutic treatment 16677802 Human
hgfr tumor We here demonstrate that HGFR activation promotes survival of colorectal carcinoma (CRC) cells exposed to conditions that mimic those met during tumor progression, i.e. nutrient deprivation or substrate detachment, and following chemotherapeutic treatment 16677802 Human
hgfr carcinogenesis Both p38 MAPK and HGF/HGFR signaling constitute potential molecular targets for inhibiting colorectal carcinogenesis. 16677802 Human
hgfr rcc In addition, phosphorylated HGFR/c-Met expression (using phosphorylation site-specific antibodies for pY1234/pY1235 and pY1349) was examined in 114 tumor sections of conventional RCC patients by immunohistochemistry. 16914575 Human
hgfr rcc CONCLUSIONS: Phosphorylated HGFR/c-Met may be important in the tumor progression of RCC. 16914575 Human
hgfr rcc Expression of pY1349 HGFR/c-Met is a useful predictor for metastasis and survival of conventional RCC patients. 16914575 Human
oncogene met escc Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. 11705871 Human
oncogene met escc The overexpression of oncogene MET was studied more extensively for its protein expression by immunohistochemistry in the two ESCC cell lines and their corresponding primary tissues and 61 primary ESCC resected specimens. 11705871 Human
oncogene met escc CONCLUSIONS: Multiple cancer-related genes are differentially expressed in ESCC, the oncogene MET is overexpressed in ESCC compared with normal esophageal epithelium, and its protein overexpression correlates with tumor differentiation in ESCC. 11705871 Human
oncogene met tumor metastasis Hepatocyte growth factor (HGF) signaling via its receptor, the proto-oncogene Met, alters cell proliferation and motility and has been associated with tumor metastasis. 12482975 Human

< Top >


Download all image files.
Save all PNG files.    Save all PDF files.    Save all PS files.